A ‘toothache tree’ alkylamide inhibits Aδ mechanonociceptors to alleviate mechanical pain (2024)

Animals

All behavioural protocols were approved by the UC Berkeley Institutional Animal Care and Use Committee, by the Institutional Animal Care and Use Committee at the Medical College of Wisconsin, and were performed in accordance with the guidelines put forth by the National Institutes of Health. Male C57/B6 mice between 8 and 14 weeks old were used. Mice were housed with unrestricted access to food and water and maintained on a 12:12 h light–dark cycle in a controlled environment. Animals were housed individually for all behavioural assays.

Behavioural assays

von Frey, radiant heat and hot plate assays were carried out essentially as described (Hargreaves et al. 1988; Chaplan et al. 1994; Cao et al. 1998). Briefly, animals were acclimated in the corresponding assay chambers starting 2 days before the day of the assay. To induce neurogenic inflammation, 5 μL of 10% allyl isothiocyanate (Sigma, St. Louis, MO, USA) in mineral oil was applied topically to the plantar and hairy surfaces of one hindpaw. For topical application to skin, sanshool was diluted in dimethylformamide (DMF) at 50 mm and 5 μl was applied to the plantar surface of the hindpaw. Sensory thresholds and latencies were tested 30–60 min after application of allyl isothiocyanate or sanshool. All behavioural assays were performed with the experimenter blind to treatment. Animals were killed by CO₂ inhalation followed by cervical dislocation immediately after all experiments.

Teased nerve fibre recordings

Mice were briefly anaesthetized with isoflurane and killed via cervical dislocation. Subsequently, the skin from the hindpaw along with the saphenous nerve was dissected, placed corium side up and superfused with synthetic interstitial fluid as previously described (Reeh, 1986). The nerve was teased into thin filaments until extracellular recordings were obtained from isolated receptive fields. Data were collected using a PowerLab 4/sp, and were recorded and analysed using the Chart program (v5.5.6; ADInstruments, Colorado Springs, CO, USA). Receptive fields were identified with a mechanical probe. Fibres were characterized according to their conduction velocity, von Frey thresholds and adaptation to a suprathreshold mechanical stimulus as previously described (Aβ≥10 ms⁻¹ > Aδ≥ 1.2 ms⁻¹ > C) (Koltzenburg et al. 1997). Aβ fibres were characterized as slowly adapting if they responded throughout a sustained mechanical force or rapidly adapting if they respond predominantly at the onset or offset of force. Aδ fibres were classified as either slowly adapting AM or rapidly adapting Down hair (D hair) receptors. D hair receptors responded to very low mechanical forces (≪1 mN), whereas AM fibres exhibited mechanical thresholds ≥4 mN. Furthermore, D hair receptors had very large receptive fields (up to 8 mm in diameter) whereas AM fibres had very small (≤1 mm) discrete, sensitive receptive field spots. C fibres were all slowly adapting. The minimum AP amplitude for all fibre types was at least threefold greater than the noise level.

Fibres were exposed to sanshool or vehicle (0.2% DMF in synthetic interstitial fluid) for 5 min and stimulated with a 10 mN force for 10 s delivered by a feedback-controlled, computer driven mechanical probe, 0.8 mm in diameter with a smooth flat end (Kwan et al. 2009). Fibres were stimulated before exposure to sanshool or vehicle, at 1 min intervals during the exposure to compounds and then at 2 min intervals after the exposure. The same protocol was used for electrical stimulation, except a 10% suprathreshold stimulus was delivered to the receptive field. For concentration and mechanical stimulus dose–responses, AM fibres were exposed to different concentrations of sanshool for 2 min (20, 60, 100 or 200 μm sanshool). Subsequently, these fibres were stimulated with increasing mechanical forces (10, 40, 100 and 200 mN) at 1 min intervals in the presence of sanshool.

Cell and neuron cultures

Chinese hamster ovary cells stably expressing recombinant human Na_v1.1, 1.2, 1.3, 1.6, 1.7 or 1.8 (Chantest, Cleveland, OH, USA) were cultured in Ham's F12 media (Life Technologies, Carlsbad, CA, USA) supplemented with 10% foetal bovine serum; Na_v1.9-expressing cells were not available. Pilot studies were conducted on human embryonic kidney cells stably expressing recombinant human Na_v1.7 (gift from T. Cummins). Dorsal root ganglion (DRG) neuron cultures were prepared as previously described (Bautista et al. 2008). Neurons were dissociated from dissected DRGs from adult (>8-week-old) animals. Culture media was minimal essential medium (Life Technologies) supplemented with glutamine (Thermo Scientific, Logan, UT, USA), MEM vitamin (Thermo Scientific) and penicillin-streptomycin (Thermo Scientific). Neurons were plated on round coverslips coated with poly-d-lysine and laminin, as previously described (Malin et al. 2007), were incubated overnight at 37°C/5% CO₂, and assayed the following day.

Calcium imaging

Calcium imaging was carried out essentially as described (Lennertz et al. 2010). Assays were performed in extracellular Ringer's solution containing (in mm): 140 NaCl, 5 KCl, 10 Hepes, 10 glucose, 2 MgCl₂, 2 CaCl₂; pH 7.4. An increase in Fura-2 ratio of >20% over baseline was considered a response.

Quantitation of sodium channel mRNA expression

Between three and 10 cultured neurons classified based on their calcium response to sanshool and cell size were collected and pooled in lysis buffer using a pulled glass pipette. Lysis buffer contained (in mm): 75 KCl, 50 Tris-Cl (pH 8.3), 3 MgCl₂ with 2 U μL⁻¹ RNAsin (Promega, Madison, WI, USA). For a single biological replicate, cells from two to four experiments were pooled and treated with DNase (TURBO DNAfree, Life Technologies). First strand synthesis was carried out according to manufacturer's specifications (Superscript III, Life Technologies). Quantitative PCR (qPCR) was carried out on a StepOnePlus Real-time PCR System using SYBR GreenER reagents (Life Technologies) with primers for Na_v channels described previously (Lopez-Santiago et al. 2006). qPCR for each channel subtype was carried out in triplicates. Expression of a channel subtype was defined as amplification of product and determination of a Ct value in two of three replicates within each sample. For quantitation of expression levels, all experiments were normalized to beta actin (forward: cacccgcgagcacagcttctttg, reverse: catgccggagccgttgtcgacg).

Electrophysiology

Whole-cell patch clamp recordings were made with an Axopatch 200B amplifier (Molecular Devices, Downingtown, PA, USA). Data were sampled at 10 kHz and filtered at 2 kHz. Data were acquired with PClamp10 (Molecular Devices, Natick, MA, USA) and analysed with custom scripts in MATLAB (Mathworks). Fire-polished electrodes (1–2 MΩ) were fabricated from borosilicate glass (Sutter, Instrument Company, Novato, CA, USA). Series resistance was compensated for by 90–95% and capacitance artefact was cancelled using the amplifier circuitry. For current clamp recordings, neurons that had resting membrane potential less than −50 mV were used.

Internal solution for voltage clamp recordings contained (in mm): 140 CsF, 10 NaCl, 5 Hepes, 1 EGTA, 2 MgCl₂, 1 MgATP, 0.1 NaGTP 0.1 cAMP; pH 7.3. Internal solution for current clamp recordings contained (in mm): 140 potassium aspartate, 13.5 NaCl, 9 Hepes, 0.09 EGTA, 1.6 MgCl₂, 1 MgATP, 0.1 NaGTP; pH 7.3. Standard Ringer's solution was used for current clamp recordings and Chinese hamster ovary cell voltage clamp recordings. For sodium current recordings in DRG neurons, extracellular solutions with reduced sodium contained: (in mm): 70/35/10 NaCl, 50/85/105 choline chloride, 20 TEACl, 5 KCl, 10 Hepes, 10 glucose, 2 MgCl₂, 2 CaCl₂, 0.1 CdCl₂; pH 7.4. All solutions were adjusted to 305–320 mosmol kg⁻¹ with 1 m mannitol.

A hydroxypropyl-β-cyclodextrin solution was added at 200 μm to extracellular solutions before addition of either DMF vehicle or sanshool stock. Solutions were subsequently sonicated in a water bath for 3–5 min. TTX was used at a final concentration of 300 nm.

Other reagents

Hydroxy-α-sanshool was purified from ethereal extracts of ground Szechuan peppercorns by Irvine Chemistry Laboratory (Anaheim, CA, USA) or prepared in-house. The purity of the compound was confirmed by H₁-NMR as previously described (Bautista et al. 2008). Stock solution of sanshool was dissolved in DMF at 100 mm.

Data analysis

Fura-2 ratios were calculated using Metafluor (Molecular Devices). Cellular electrophysiology data was analysed in Clampfit 10.2 (Molecular Devices). Further analyses and statistical comparisons were carried out in MATLAB (Mathworks). For conductance–potential curves, whole-cell current (I) data were first converted to conductances (G) using the equation G=I/(V−V_rev), where V is the command potential and V_rev is the reversal potential. Subsequently, conductance was fit to the Boltzmann equation G=G_max/(1 + exp((V_1/2−V)/k)), where G_max is the maximum conductance, V_1/2 is the half-maximal conductance potential and k is a slope factor. For steady-state inactivation curves, normalized current (I_norm) was fit to the equation I_norm= 1/(1 +exp ((V−V_h)/k)), where V_h is the potential for half-maximal reduction in current and k is a slope factor. The double Boltzmann equation, used to fit steady-state inactivation data in DRG neurons, was I_norm=f/(1 +exp ((V−V_h1)/k₁)) + (1 −f)/(1 + exp((V− V_h2)/k₂)), where f is the fraction of current contributed by one of two classes of Na_v channels with either a higher or lower half-maximal potential for reduction in steady-state current. The value of f was chosen to numerically minimize the confidence intervals of both V_h1 and V_h2. All voltages were adjusted during data analysis according to experimentally measured junction potentials for each corresponding pair of solutions.

Behavioural responses to mechanical stimuli are reduced by sanshool

To examine the analgesic properties of sanshool, we measured the effect of topical application of sanshool on mouse somatosensory behaviours. Topical application of sanshool to the hindpaw plantar surface did not evoke any spontaneous licking, flinching or other obvious behaviours. However, topical sanshool significantly elevated the mechanical thresholds for paw withdrawal, as measured using the von Frey assay 60 min after sanshool application (Fig. 1A). In contrast, sanshool did not alter responsiveness to noxious thermal stimuli in the radiant heat paw withdrawal assay (Fig. 1B), or the hot plate test (Fig. 1C). These results suggest that sanshool specifically reduces baseline sensitivity to mechanical stimuli.

Because sanshool is used as a traditional medicine to treat inflammatory pain, we next measured the effect of sanshool on mechanical and heat sensitivity in a model of neurogenic inflammation. Topical application of mustard oil (10%) induced mechanical and heat hypersensitivity that was observed as a significant reduction in mechanical threshold for paw withdrawal and thermal paw withdrawal latency (Fig. 1D). Following induction of hypersensitivity by mustard oil, topical application of sanshool greatly attenuated the decrease in mechanical threshold while vehicle had no effect (Fig. 1D). Similar to its effect on naïve animals, sanshool did not alter hypersensitivity to noxious heat stimuli during mustard oil-induced neurogenic inflammation (Fig. 1E). Thus, sanshool selectively attenuates mechanical pain hypersensitivity.

Sanshool suppresses the mechanosensitivity of somatosensory fibres

We next used the ex-vivo skin–nerve preparation to determine if sanshool alters sensory transduction in the peripheral nervous system, and if so, whether sanshool targets specific subsets of somatosensory fibre types. As we have shown previously that sanshool activates rapidly adapting Aβ and Aδ fibres as well as a subset of C fibre nociceptors (Lennertz et al. 2010), we focused our study on fibres that display little or no sanshool-evoked excitation (Table 1). Nerve fibres were mechanically stimulated while the receptive fields were exposed to either vehicle (0.2% DMF), or sanshool (200 μm; Fig. 2A). Sanshool inhibited mechanically evoked AP firing in most AM fibres (90%) and a subset of slowly adapting Aβ fibres (38%) (Fig. 2A–C). In contrast, all mechanically sensitive C fibres continued to display mechanically evoked AP firing in the presence of sanshool (0%) (Fig. 2A–C). Fibre inhibition was concentration-dependent, with an IC₅₀ of 70 ± 7 μm for AM fibres in response to 100 mN force (Fig. 2D). Sanshool inhibition was observed at a wide range of applied mechanical forces (Fig. 2E). A maximal inhibitory effect was observed after ∼4 min of 200 μm sanshool application; in some AM fibres, such inhibition persisted for more than 30 min following the wash out of sanshool (data not shown). These data demonstrate that sanshool strongly inhibits mechanical responses in slowly-adapting, myelinated fibres, especially the AM fibres, which mediate sharp acute mechanical pain as well as the hypersensitivity to mechanical pain after neurogenic inflammation (Lin et al. 2000; Magerl et al. 2001). These findings are consistent with the use of toothache tree extracts to treat inflammatory hypersensitivity in areas densely innervated by myelinated mechanosensitive pain fibres (e.g. tooth pulp or joints) (Heppelmann et al. 1988; Paik et al. 2010).

Electrical excitability of sensory fibres and dissociated sensory neurons is suppressed by sanshool

Sanshool may attenuate mechanically evoked AP firing by either inhibiting mechanosensitive channels that trigger excitability, or by directly inhibiting voltage-gated channels. Thus, we questioned whether sanshool inhibits AP firing using an electrical stimulus, which would bypass mechanical transduction. We found that sanshool attenuated the electrically evoked AP firing in all AM fibres and in a subset of slowly adapting Aβ fibres, but in contrast had no effect on C fibres (Fig. 3A and B). The time course of recovery of electrical excitability correlated well with the recovery of mechanical excitability (data not shown). This experiment suggests that sanshool inhibits the initiation or propagation of APs in slowly adapting, myelinated fibres, independently of its effect on mechanical transduction.

Consistent with its effect on sensory fibres, sanshool also inhibited electrically evoked AP firing in a subset of cultured DRG neurons (Fig. 3C and D). Sanshool completely inhibited AP firing in 35% of neurons, and significantly reduced the AP amplitude in another 29% of sensory neurons following injection of suprathreshold current (n= 31; Fig. 3D). Another 36% were unaffected by sanshool. The sanshool-induced AP inhibition was concentration-dependent with an IC₅₀ of 56 μm (n= 4, data not shown).

Sanshool-sensitive neurons had distinct physical and physiological characteristics compared to sanshool-resistant neurons. First, larger diameter neurons (>28 μm) were more likely to be inhibited by sanshool (nine of 16 large diameter vs. two of 15 small diameter; P < 0.05, Fisher's exact test). This result is consistent with the inhibition of myelinated fibres in our teased fibre recordings (Fig. 2). Small diameter neurons tend to express higher levels of Na_v channels that are resistant to the specific sodium channel blocker TTX, such as Na_v1.8, as compared to larger diameter neurons (Black et al. 1996; f*ckuoka et al. 2008). Accordingly, the small diameter neurons that were insensitive to sanshool were also resistant to TTX (86%). Second, neurons inhibited by sanshool had a more hyperpolarized threshold for AP firing at baseline (Fig. 3E). Na_v channels expressed in sensory neurons are activated at different membrane potentials depending on the channel subtype (Rush et al. 2005). Therefore, sanshool-sensitive neurons may express Na_v channels that are activated at a more hyperpolarized membrane potential and are preferentially inhibited by sanshool.

Sanshool attenuates excitability by inhibiting voltage-gated sodium channels in dorsal root ganglion neurons

We next used whole-cell voltage clamp recording to examine the effects of sanshool on endogenous Na_v channels in sensory neurons. The application of sanshool caused a rapid and reversible reduction in voltage-gated sodium current amplitude (Fig. 4A–D). Classification of neurons based on their sensitivity to TTX showed that TTX sensitivity is weakly correlated with sanshool sensitivity (Fig. 4E).

Many Na_v channel inhibitors act by preferentially binding to the inactivated state of the channel, which promotes a hyperpolarizing shift in the steady-state inactivation curve (Hille, 1977; Bean et al. 1983). We thus measured voltage-dependent steady-state inactivation of Na_v channels in the absence and presence of sanshool (Fig. 4F). Sensory neurons express multiple sodium channel subtypes that differ in sensitivity to voltage-dependent inactivation. As such, our data were best fit with either a single or a double Boltzmann function to determine a single or two midpoint(s) for inactivation (V_h), respectively (see Materials and methods for fit assumptions) (Rush et al. 2005; Kistner et al. 2010). Sanshool caused a significant hyperpolarizing shift in both V_h1 and V_h2 (Fig. 4G), suggesting that sanshool may promote steady-state inactivation at or near the resting potential.

Sodium channel subtypes are selectively sensitive to sanshool

If sanshool dampens sensory neuron excitability by inhibiting Na_v channels, sanshool sensitivity may correlate with the expression of sanshool-sensitive Na_v channel subtypes. Our initial characterization showed that sensory neurons expressing TTX-sensitive Na_v channels tend to be more strongly inhibited, while those expressing TTX-resistant Na_v channels are less suppressed by sanshool (Fig. 4E). However, TTX sensitivity of AP firing did not correlate strictly with sanshool sensitivity, as many TTX-sensitive large diameter neurons were still resistant to the inhibitory effect of sanshool. We thus sought to determine the specific Na_v channel subtypes expressed in neurons inhibited by sanshool.

Because molecular markers are not yet available to differentiate among somas of myelinated fibre subtypes in culture and soma size is a rough marker of functional subtypes, we used a ‘next best’ approach. We used calcium imaging to functionally classify neurons and then performed qPCR on subgroups of neurons to identify Na_v channel subtype expression. Neurons were classified into three groups based on soma size and calcium response to sanshool (Fig. 5A). Group I neurons are larger in diameter and activated by sanshool, as previously described (Lennertz et al. 2010). Group I neurons likely correspond to myelinated light touch receptors, including rapidly adapting Aβ, some slowly adapting Aβ and rapidly adapting Aδ fibres. Group II neurons are also large diameter but are not activated by sanshool, and represent neurons that are more likely to be silenced (AM and another subset of slowly adapting Aβ fibres) (Fig. 5A). Group III small diameter neurons are activated by capsaicin and thus include a population of C fibre nociceptors. Neurons from each group were pooled and Na_v channel mRNA expression levels were measured by qPCR.

The three groups of neurons displayed unique combinations of Na_v channel subtype expression (Fig. 5B, Supplemental Fig. 1). Group I neurons expressed all subtypes tested except for Na_v1.8. Similarly, group II neurons expressed most Na_v channel subtypes, including Na_v1.8, with the exception of Na_v1.2. Group III neurons only expressed Na_v1.7 and 1.8. These results are consistent with the previously described distribution of Na_v channel subtypes based on relative cell size (Black et al. 1996; f*ckuoka et al. 2008; ). Notably, larger diameter neurons that express both Na_v1.7 and Na_v1.8 probably include Aδ nociceptors (Djouhri et al. 2003a,b). These data suggest that Na_v1.2 expression may underlie the resistance of larger diameter neurons to sanshool, and that Na_v1.2 may be more resistant to sanshool than other subtypes. To test this, we characterized the degree of current block at 0 mV and the shift in steady-state inactivation induced by sanshool in Na_v channel subtypes expressed heterologously.

All Na_v channels tested displayed voltage-gated currents that were reduced, to varying degrees, by sanshool (Fig. 5C and D). Notably, Na_v1.3 and 1.7 displayed significantly more block at 0 mV as compared to Na_v1.1, 1.2, 1.6 and 1.8, with Na_v1.2 displaying the least sensitivity (Fig. 5D and E). There are several classes of Na_v channel inhibitors that have different mechanisms of action. Local anaesthetics, such as lidocaine, act by binding to the open or inactivated state of Na_v channels (Hille, 1977; Ragsdale et al. 1994). Plotting the strength of sanshool-induced current inhibition against the mid-point for steady-state inactivation showed a clear correlation. The inhibition by sanshool tended to be stronger as the fraction of inactivated channels at resting potential increased (Fig. 5F). In DRG neurons, sanshool caused a hyperpolarizing shift in the steady-state inactivation curve of endogenous sodium channels (Fig. 4F and G). Interestingly, even though sanshool shifted the steady-state inactivation of all heterologously expressed Na_v channels, sanshool caused the biggest shift in Na_v1.7 (Fig. 5G and H). These results suggest that at resting potential, sanshool is likely to have the most profound inhibitory effect on the activity of Na_v1.7 channels. Overall, sanshool inhibits Na_v channel subtypes to varying degrees, and differences in the relative contribution of each channel subtype to excitability may dictate sanshool sensitivity among the different groups of neurons.

Selective silencing of myelinated nociceptors

Sanshool is commonly used to treat toothache and rheumatoid arthritis. Structural and staining studies have shown that many fibres innervating the tooth pulp and knee joints are lightly myelinated and have free nerve endings, indicative of Aδ nociceptors (Heppelmann et al. 1988; Paik et al. 2010). In addition, recordings from fibres innervating the knee joint confirm that many of these fibres display functional properties of Aδ fibres (Guilbaud et al. 1985). In models of inflammatory pain, both myelinated and unmyelinated nociceptors have lower response thresholds, increased spontaneous activity and higher stimulus-evoked AP firing rate (Guilbaud et al. 1985; ). Aδ fibres in particular may be sensitized during neurogenic inflammation via the release of inflammatory mediators such as substance P that then sensitizes Aδ terminals (; Magerl et al. 2001). Thus sanshool may be a highly effective analgesic for inflammatory pain because of its preferential silencing of Aδ mechanonociceptors.

Differential inhibition of Na_v channel subtypes

The analgesic properties of sanshool resemble those of local anaesthetics (LAs) such as lidocaine, at both the physiological and molecular levels. LAs preferentially bind to the open and inactivated states of Na_v channels by binding to specific residues in the S6 segments within the ion-conduction pore (Hille, 1977; Ragsdale et al. 1994). Structure–function studies for an insecticidal alkylamide that is structurally related to sanshool showed that the residues in S6 required for LA activity are also important for inhibition by alkylamides (Du et al. 2011). The leftward shift in the steady-state inactivation curve induced by sanshool also suggests that sanshool may bind to the open and/or inactivated state of Na_v channels.

Like sanshool, LAs also display channel subtype specificity (; Chevrier et al. 2004; Leffler et al. 2007; Kistner et al. 2010). For example, the efficacy of block by lidocaine is dependent on the fraction of inactivated channels present at a given membrane potential, and this fraction varies between channel subtypes (Wright et al. 1997; Herzog et al. 2003; Rush et al. 2005; Leffler et al. 2007; Kistner et al. 2010). The different subtypes of Na_v channels expressed in DRG neurons also displayed varying degrees of sanshool-induced tonic inhibition at resting potentials (Fig. 5). Na_v1.7 and 1.3 display the most hyperpolarized steady-state inactivation, indicating that more channels are inactivated at rest compared to other DRG neuron sodium channels, such as Na_v1.2. This in turn would allow sanshool to inhibit Na_v1.7 and 1.3 more potently than Na_v1.2. Although both Na_v1.7 and 1.3 voltage-gated currents were inhibited strongly by sanshool, Na_v1.7 was unique in that its steady-state inactivation curve was shifted significantly more compared to other subtypes (Fig. 5). Thus the potent, dual action of sanshool on the current magnitude and steady-state inactivation properties of Na_v1.7 may make this channel subtype particularly susceptible to sanshool.

Na_v channel subtypes in sensory fibre function

Our Na_v channel subtype expression and sanshool- sensitivity analyses (Fig. 5) suggest a model in which somatosensory neurons can be classified functionally based on their dependence on distinct but overlapping sets of Na_v channel subtypes for maintaining excitability. Aδ nociceptors and slowly adapting Aβ fibres (represented by group II neurons) may be more likely to be inhibited by sanshool because they rely on Na_v1.7 and/or Na_v1.3. In contrast, rapidly adapting Aβ fibres (represented by group I neurons) are resistant to sanshool possibly because they rely less on Na_v1.7 and/or Na_v1.3 for excitability. C fibres (represented by group III neurons) are also resistant to sanshool because they rely on Na_v1.8, which is more resistant to sanshool as compared to Na_v1.7. These results support a model in which different Na_v channels play specific roles in somatosenosory neuron function.

Unfortunately, we were unable to probe the sanshool sensitivity of Nav1.9 as there is no readily available and reliable source of Nav1.9 expressing cell lines. However, Nav1.9 is unlikely to play a key role in sanshool-evoked neuronal silencing because expression is limited to small diameter neurons and is unlikely to contribute to excitability of the sanshool-sensitive neurons (f*ckuoka et al. 2008; ). In addition, Nav1.9 does not contribute to the rising phase of the AP (Herzog et al. 2001; ), thus it is unclear how sanshool sensitivity would affect AP firing.

The role of Na_v1.3 in somatosensory neurons remains enigmatic. Expression of Na_v1.3 is robust embryonically and after axotomy or nerve injury, but is otherwise weak (Waxman et al. 1994; Black et al. 1999; Kim et al. 2001). In addition, Na_v1.3 expression is robust in dissociated DRG cultures whereas very little is detected in situ in tissue slices (Black et al. 1996). Likewise, our results showed robust expression of Na_v1.3 in dissociated group I and II neurons. Thus, the relative contribution of Na_v1.3 to sanshool sensitivity in vivo is unclear.

Previous studies of Na_v channel subtype expression in DRG neurons suggest that Na_v1.7 is expressed in a large population of neurons (Black et al. 1996; f*ckuoka et al. 2008; ). Aδ nociceptors in particular express relatively high levels of Na_v1.7 as well as Na_v1.8 (Djouhri et al. 2003a,b). In addition, Na_v1.7 expression is upregulated during inflammation of the tooth pulp and joints (Luo et al. 2008; Strickland et al. 2008). However, the functional contribution of each Na_v subtype in Aδ nociceptors is not known. Our results implicate Na_v1.7 as a critical mediator of Aδ nociceptor excitability, perhaps due to its proposed role in impulse initiation (Cummins et al. 1998). Consistent with this model, Na_v1.7 expression has been observed in nerve endings of cutaneous myelinated nociceptors (Black et al. 2012). Future fibre recordings using Na_v1.7 and Na_v1.8 knockout mice, or Na_v1.7-specific inhibitors (not commercially available), are needed to test this hypothesis.

Na_v1.7 is also expressed in a subset of Aβ fibres that respond to gentle mechanical stimulation (Djouhri et al. 2003b). Our results suggest that Na_v1.7 may also contribute to AP firing in a subset of slowly adapting Aβ fibres. The functional consequence of inhibiting Na_v1.7 in these fibres is unclear. However, the reduced behavioural mechanosensitivity induced by sanshool in naïve animals may partly be due to sanshool's inhibitory effect on these tactile fibres.

Many unmyelinated nociceptors also express Na_v1.7 and Na_v1.8 (Black et al. 1996; Djouhri et al. 2003a,b; f*ckuoka et al. 2008; ; Shields et al. 2012). However, C fibres remained largely resistant to the inhibitory effect of sanshool. While our PCR results suggest that Na_v1.8 mRNA is expressed at similar levels between group II and group III neurons (Supplementary Fig. 1), there may be differential expression of Na_v1.8 protein. In addition, electrophysiologically, unmyelinated nociceptors appear to rely more on Na_v1.8 for AP generation (). Indeed, the relative resistance of C fibres to lidocaine is thought to be due to high expression of Na_v1.8 in these fibres (Kistner et al. 2010). Thus, sanshool resistance of C fibres may also be due to their reliance on Na_v1.8, which is relatively insensitive to sanshool, for initiation of APs.

Acute, peripheral inhibition of mechanical pain by sanshool

We have previously shown that sanshool activates a subset of primary afferents, including Aβ fibres to induce tingling paraesthesia (Table 1) (Lennertz et al. 2010). Thus, it is possible sanshool-evoked analgesia may be indirect, as Aβ fibre activity can modulate nociceptor activity through central inhibition (; Woolf et al. 1980). However, central inhibition would be expected to alter both mechanical and thermal responsiveness (Chung et al. 1984; Paik et al. 1988) and cannot explain the activity of sanshool in the skin–nerve or in vivo experiments. Thus our data support a model whereby sanshool directly inhibits peripheral nociceptor terminals to mediate analgesia.

Studies on Na_v channel knockout mice have shown significant roles for Na_v1.7 in somatosensory behaviour. Na_v1.7 is required for normal responses to radiant heat and noxious mechanical stimuli, but this channel is not required for responses to a noxious hot plate (Minett et al. 2012). As such, it has been proposed that neurons that predominantly depend on Na_v1.7 are involved in acute thermal pain responses, while neurons that express both Na_v1.7 and Na_v1.8 mediate mechanical and inflammatory pain (Nassar et al. 2004; Minett et al. 2012). Humans with loss of function mutations in Na_v1.7 do not experience pain in response to noxious mechanical or thermal stimuli (Cox et al. 2006). The lack of an effect of sanshool on thermal sensitivity was surprising given these studies. However, differences between acute inhibition of function and chronic genetic loss of Na_v1.7 through development may account for such differences. Additionally, inhibition of other channel subtypes by sanshool may contribute to the specificity of sanshool action. One such possibility might suggest that the dual suppression of Na_v1.7 and Na_v1.3 by sanshool results in selective silencing of Aδ mechanoreceptors and subsequent inhibition of mechanical pain. Regardless, our data offer insights into the mechanism by which modality-specific analgesia is induced by sanshool. In addition, the development of synthetic sanshool derivatives (Wu et al. 2012) may be useful for treating painful inflammatory conditions that involve sensitization of myelinated mechanosensitive nociceptors.

Competing interests

None.

Author contributions

M.T. was responsible for the conception and design of experiments; collection, analysis and interpretation of data; drafting the article. R.C.L. was involved in the conception and design of experiments; collection, analysis and interpretation of data; drafting the article. D.V. dealt with the collection, analysis and interpretation of data. S.K. was involved in the collection, analysis and interpretation of data. C.L.S. contributed towards the conception and design of experiments and drafting of the article. D.M.B. was involved in the conception and design of experiments and drafting of the article. All authors approved the final version of the manuscript.

Behavioural assays, cellular electrophysiology and molecular biology were performed at UC Berkeley. Ex-vivo skin–nerve experiments and cellular electrophysiology were carried out at Medical College of Wisconsin.

Funding

This work was supported by the National Institutes of Health grants NS40538 and NS070711 to C.L.S. and AR059385 and DOD007123A to D.M.B.

• Bautista DM, Sigal YM, Milstein AD, Garrison JL, Zorn JA, Tsuruda PR, Nicoll RA, Julius D. Pungent agents from Szechuan peppers excite sensory neurons by inhibiting two-pore potassium channels. Nat Neurosci. 2008;11:772–779. [PMC free article] [PubMed] [Google Scholar]
• Bean BP, Cohen CJ, Tsien RW. Lidocaine block of cardiac sodium channels. J Gen Physiol. 1983;81:613–642. [PMC free article] [PubMed] [Google Scholar]
• Black JA, Dib-Hajj S, McNabola K, Jeste S, Rizzo MA, Kocsis JD, Waxman SG. Spinal sensory neurons express multiple sodium channel alpha-subunit mRNAs. Brain Res Mol Brain Res. 1996;43:117–131. [PubMed] [Google Scholar]
• Black JA, Cummins TR, Plumpton C, Chen YH, Hormuzdiar W, Clare JJ, Waxman SG. Upregulation of a silent sodium channel after peripheral, but not central, nerve injury in DRG neurons. J Neurophysiol. 1999;82:2776–2785. [PubMed] [Google Scholar]
• Black JA, Frézel N, Dib-Hajj SD, Waxman SG. Expression of Nav1.7 in DRG neurons extends from peripheral terminals in the skin to central preterminal branches and terminals in the dorsal horn. Mol Pain. 2012;8:82. [PMC free article] [PubMed] [Google Scholar]
• Blair NT, Bean BP. Roles of tetrodotoxin (TTX)-sensitive Na⁺ current, TTX-resistant Na⁺ current, and Ca²⁺ current in the action potentials of nociceptive sensory neurons. J Neurosci. 2002;22:10277–10290. [PMC free article] [PubMed] [Google Scholar]
• Brown AG, Iggo A. A quantitative study of cutaneous receptors and afferent fibres in the cat and rabbit. J Physiol. 1967;193:707–733. [PMC free article] [PubMed] [Google Scholar]
• Bryant BP, Mezine I. Alkylamides that produce tingling paresthesia activate tactile and thermal trigeminal neurons. Brain Res. 1999;842:452–460. [PubMed] [Google Scholar]
• Cao YQ, Mantyh PW, Carlson EJ, Gillespie AM, Epstein CJ, Basbaum AI. Primary afferent tachykinins are required to experience moderate to intense pain. Nature. 1998;392:390–394. [PubMed] [Google Scholar]
• Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994;53:55–63. [PubMed] [Google Scholar]
• Chevrier P, Vijayaragavan K, Chahine M. Differential modulation of Nav1.7 and Nav1.8 peripheral nerve sodium channels by the local anesthetic lidocaine. Br J Pharmacol. 2004;142:576–584. [PMC free article] [PubMed] [Google Scholar]
• Chung JM, Lee KH, Hori Y, Endo K, Willis WD. Factors influencing peripheral nerve stimulation produced inhibition of primate spinothalamic tract cells. Pain. 1984;19:277–293. [PubMed] [Google Scholar]
• Cox JJ, Reimann F, Nicholas AK, Thornton G, Roberts E, Springell K, Karbani G, Jafri H, Mannan J, Raashid Y, Al-Gazali L, Hamamy H, Valente EM, Gorman S, Williams R, McHale DP, Wood JN, Gribble FM, Woods CG. An SCN9A channelopathy causes congenital inability to experience pain. Nature. 2006;444:894–898. [PMC free article] [PubMed] [Google Scholar]
• Cummins TR, Howe JR, Waxman SG. Slow closed-state inactivation: a novel mechanism underlying ramp currents in cells expressing the hNE/PN1 sodium channel. J Neurosci. 1998;18:9607–9619. [PMC free article] [PubMed] [Google Scholar]
• Djouhri L, Fang X, Okuse K, Wood JN, Berry CM, Lawson SN. The TTX-resistant sodium channel Nav1.8 (SNS/PN3): expression and correlation with membrane properties in rat nociceptive primary afferent neurons. J Physiol. 2003a;550:739–752. [PMC free article] [PubMed] [Google Scholar]
• Djouhri L, Newton R, Levinson SR, Berry CM, Carruthers B, Lawson SN. Sensory and electrophysiological properties of guinea-pig sensory neurones expressing Nav 1.7 (PN1) Na⁺ channel subunit protein. J Physiol. 2003b;546:565–576. [PMC free article] [PubMed] [Google Scholar]
• Du Y, Garden D, Khambay B, Zhorov BS, Dong K. Batrachotoxin, pyrethroids, and BTG 502 share overlapping binding sites on insect sodium channels. Mol Pharmacol. 2011;80:426–433. [PMC free article] [PubMed] [Google Scholar]
• Eijkelkamp N, Linley JE, Baker MD, Minett MS, Cregg R, Werdehausen R, Rugiero F, Wood JN. Neurological perspectives on voltage-gated sodium channels. Brain. 2012;135:2585–2612. [PMC free article] [PubMed] [Google Scholar]
• Foster S, Duke JA. Zanthoxylum. In: Peterson RT, editor. A Field Guide to Medicinal Plants and Herbs: Of Eastern and Central North America. 2nd edn. Boston: Houghton Mifflin Harcourt; 1999. pp. 268–269. [Google Scholar]
• f*ckuoka T, Kobayashi K, Yamanaka H, Obata K, Dai Y, Noguchi K. Comparative study of the distribution of the alpha-subunits of voltage-gated sodium channels in normal and axotomized rat dorsal root ganglion neurons. J Comp Neurol. 2008;510:188–206. [PubMed] [Google Scholar]
• Guilbaud G, Iggo A, Tegnér R. Sensory receptors in ankle joint capsules of normal and arthritic rats. Exp Brain Res. 1985;58:29–40. [PubMed] [Google Scholar]
• Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception. Pain. 1988;32:77–88. [PubMed] [Google Scholar]
• Harper BYAA, Lawson SN. Conduction velocity is related to morphological cell type in rat dorsal root ganglion neurones. J Physiol. 1985;359:31–46. [PMC free article] [PubMed] [Google Scholar]
• Heppelmann B, Heuss C, Schmidt RF. Fiber size distribution of myelinated and unmyelinated axons in the medial and posterior articular nerves of the cat's knee joint. Somatosens Mot Res. 1988;5:273–281. [PubMed] [Google Scholar]
• Herbert MK, Schmidt RF. Sensitisation of group III articular afferents to mechanical stimuli by substance P. Inflamm Res. 2001;50:275–282. [PubMed] [Google Scholar]
• Herzog RI, Cummins TR, Waxman SG. Persistent TTX-resistant Na⁺ current affects resting potential and response to depolarization in simulated spinal sensory neurons. J Neurophysiol. 2001;86:1351–1364. [PubMed] [Google Scholar]
• Herzog RI, Cummins TR, Ghassemi F, Dib-Hajj SD, Waxman SG. Distinct repriming and closed-state inactivation kinetics of Nav1.6 and Nav1.7 sodium channels in mouse spinal sensory neurons. J Physiol. 2003;551:741–750. [PMC free article] [PubMed] [Google Scholar]
• Hille B. Local anesthetics: hydrophilic and hydrophobic pathways for the drug-receptor reaction. J Gen Physiol. 1977;69:497–515. [PMC free article] [PubMed] [Google Scholar]
• Ho C, O’Leary ME. Single-cell analysis of sodium channel expression in dorsal root ganglion neurons. Mol Cell Neurosci. 2011;46:159–166. [PMC free article] [PubMed] [Google Scholar]
• Iggo A. Cutaneous mechanoreceptors with afferent C fibres. J Physiol. 1960;152:337–353. [PMC free article] [PubMed] [Google Scholar]
• Kim CH, Oh Y, Chung JM, Chung K. The changes in expression of three subtypes of TTX sensitive sodium channels in sensory neurons after spinal nerve ligation. 2001;95:153–161. [PubMed] [Google Scholar]
• Kistner K, Zimmermann K, Ehnert C, Reeh PW, Leffler A. The tetrodotoxin-resistant Na⁺ channel Nav1.8 reduces the potency of local anesthetics in blocking C-fiber nociceptors. Eur J Physiol. 2010;459:751–763. [PubMed] [Google Scholar]
• Koltzenburg M, Stucky CL, Lewin GR. Receptive properties of mouse sensory neurons innervating hairy skin receptive properties of mouse sensory neurons innervating hairy skin. J Neurophysiol. 1997;78:1841–1850. [PubMed] [Google Scholar]
• Kwan KY, Glazer JM, Corey DP, Rice FL, Stucky CL. TRPA1 modulates mechanotransduction in cutaneous sensory neurons. J Neurosci. 2009;29:4808–4819. [PMC free article] [PubMed] [Google Scholar]
• Leffler A, Reiprich A, Mohapatra DP, Nau C. Use-dependent block by lidocaine but not amitriptyline is more pronounced in tetrodotoxin (TTX)-resistant Nav1.8 than in TTX-sensitive Na⁺ channels. J Pharmacol Exp Ther. 2007;320:354–364. [PubMed] [Google Scholar]
• Lennertz RC, Tsunozaki M, Bautista DM, Stucky CL. Physiological basis of tingling paresthesia evoked by hydroxy-alpha-sanshool. J Neurosci. 2010;30:4353–4361. [PMC free article] [PubMed] [Google Scholar]
• Lin Q, Zou X, Willis WD. Aδ and C primary afferents convey dorsal root reflexes after intradermal injection of capsaicin in rats. J Neurophysiol. 2000;84:2695–2698. [PubMed] [Google Scholar]
• Lopez-Santiago LF, Pertin M, Morisod X, Chen C, Hong S, Wiley J, Decosterd I, Isom LL. Sodium channel beta2 subunits regulate tetrodotoxin-sensitive sodium channels in small dorsal root ganglion neurons and modulate the response to pain. J Neurosci. 2006;26:7984–7994. [PMC free article] [PubMed] [Google Scholar]
• Lumpkin EA, Marshall KL, Nelson AM. The cell biology of touch. J Cell Biol. 2010;191:237–248. [PMC free article] [PubMed] [Google Scholar]
• Luo S, Perry GM, Levinson SR, Henry Ma. Nav1.7 expression is increased in painful human dental pulp. Mol Pain. 2008;4:16. [PMC free article] [PubMed] [Google Scholar]
• Magerl W, Fuchs PN, Meyer RA, Treede RD. Roles of capsaicin-insensitive nociceptors in cutaneous pain and secondary hyperalgesia. Brain. 2001;124:1754–1764. [PubMed] [Google Scholar]
• Malin SA, Davis BM, Molliver DC. Production of dissociated sensory neuron cultures and considerations for their use in studying neuronal function and plasticity. Nat Protoc. 2007;2:152–160. [PubMed] [Google Scholar]
• McGlone F, Reilly D. The cutaneous sensory system. Neurosci Biobehav Rev. 2010;34:148–159. [PubMed] [Google Scholar]
• Melzack R, Wall PD. Pain mechanisms: a new theory. Science. 1965;150:971–979. [PubMed] [Google Scholar]
• Minett MS, Nassar Ma, Clark AK, Passmore G, Dickenson AH, Wang F, Malcangio M, Wood JN. Distinct Nav1.7-dependent pain sensations require different sets of sensory and sympathetic neurons. Nat Commun. 2012;3:791. [PMC free article] [PubMed] [Google Scholar]
• Nassar MA, Stirling LC, Forlani G, Baker MD, Matthews Ea, Dickenson AH, Wood JN. Nociceptor-specific gene deletion reveals a major role for Nav1.7 (PN1) in acute and inflammatory pain. Proc Natl Acad Sci U S A. 2004;101:12706–12711. [PMC free article] [PubMed] [Google Scholar]
• Paik KS, Nam SC, Chung JM. Differential inhibition produced by peripheral conditioning stimulation on noxious mechanical and thermal responses of different classes of spinal neurons in the cat. Exp Neurol. 1988;99:498–511. [PubMed] [Google Scholar]
• Paik SK, Lee DS, Kim JY, Bae JY, Cho YS, Ahn DK, Yoshida A, Bae YC. Quantitative ultrastructural analysis of the neurofilament 200-positive axons in the rat dental pulp. J Endod. 2010;36:1638–1642. [PubMed] [Google Scholar]
• Pereira SS, Lopes LS, Marques RB, Figueiredo Ka, Costa Da, Chaves MH, Almeida FRC. Antinociceptive effect of Zanthoxylum rhoifolium Lam. (Rutaceae) in models of acute pain in rodents. J Ethnopharmacol. 2010;129:227–231. [PubMed] [Google Scholar]
• Ragsdale DS, McPhee JC, Scheuer T, Catterall Wa. Molecular determinants of state-dependent block of Na⁺ channels by local anesthetics. Science. 1994;265:1724–1728. [PubMed] [Google Scholar]
• Reeh PW. Sensory receptors in mammalian skin in an in vitro preparation. Neurosci Lett. 1986;66:141–146. [PubMed] [Google Scholar]
• Roy ML, Narahashi T. Differential properties ganglion neurons of tetrodotoxin-sensitive and sodium channels in rat dorsal root. J Neurosci. 1992;7212:2104–2111. [PMC free article] [PubMed] [Google Scholar]
• Rush AM, Dib-hajj SD, Waxman SG. Electrophysiological properties of two axonal sodium channels, Nav1.2 and Nav1.6, expressed in mouse spinal sensory neurones. J Physiol. 2005;3:803–815. [PMC free article] [PubMed] [Google Scholar]
• Rush AM, Cummins TR, Waxman SG. Multiple sodium channels and their roles in electrogenesis within dorsal root ganglion neurons. J Physiol. 2007;579:1–14. [PMC free article] [PubMed] [Google Scholar]
• Schaible HG, Schmidt RF. Effects of an experimental arthritis on the sensory properties of fine articular afferent units. J Neurophysiol. 1985;54:1109–1122. [PubMed] [Google Scholar]
• Shields SD, Ahn H, Yang Y, Han C, Seal RP, Wood JN, Waxman SG, Dib-hajj SD. Nav1.8 expression is not restricted to nociceptors in mouse peripheral nervous system. Pain. 2012;153:2017–2030. [PubMed] [Google Scholar]
• Smith ESJ, Lewin GR. Nociceptors: a phylogenetic view. J Comp Physiol A Neuroethol Sens Neural Behav Physiol. 2009;195:1089–1106. [PMC free article] [PubMed] [Google Scholar]
• Strickland IT, Martindale JC, Woodhams PL, Reeve AJ, Chessell IP, McQueen DS. Changes in the expression of NaV1.7, NaV1.8 and NaV1.9 in a distinct population of dorsal root ganglia innervating the rat knee joint in a model of chronic inflammatory joint pain. Eur J Pain. 2008;12:564–572. [PubMed] [Google Scholar]
• Sugai E, Morimitsu Y, Iwasaki Y, Morita A, Watanabe T, Kubota K. Pungent qualities of sanshool-related compounds evaluated by a sensory test and activation of rat TRPV1. Biosci Biotechnol Biochem. 2005a;69:1951–1957. [PubMed] [Google Scholar]
• Sugai E, Morimitsu Y, Kubota K. Quantitative analysis of sanshool compounds in Japanese pepper (Xanthoxylum piperitum DC.) and their pungent characteristics. Biosci Biotechnol Biochem. 2005b;69:1958–1962. [PubMed] [Google Scholar]
• Waxman SG, Estacion M. Nav1.9, G-proteins, and nociceptors. J Physiol. 2008;586:917–918. [PMC free article] [PubMed] [Google Scholar]
• Waxman SG, Kocsis JD, Black JA. Type III sodium channel mRNA is expressed in embryonic but not adult spinal sensory neurons, and is reexpressed following axotomy. J Neurophysiol. 1994;72:466–470. [PMC free article] [PubMed] [Google Scholar]
• Woolf CJ, Mitchell D, Barrett GD. Antinociceptive effect of peripheral segmental electrical stimulation in the rat. Pain. 1980;8:237–252. [PubMed] [Google Scholar]
• Wright SN, Wang SY, Kallen RG, Wang GK. Differences in steady-state inactivation between Na channel isoforms affect local anesthetic binding affinity. Biophys J. 1997;73:779–788. [PMC free article] [PubMed] [Google Scholar]
• Wu B, Li K, Toy P. Synthesis of hydroxy-α-sanshool. Synlett. 2012;23:2564–2566. [Google Scholar]
• Zimmermann K, Leffler A, Babes A, Cendan CM, Carr RW, Kobayashi J, Nau C, Wood JN, Reeh PW. Sensory neuron sodium channel Nav1.8 is essential for pain at low temperatures. Nature. 2007;447:855–858. [PubMed] [Google Scholar]